BLASTN 2.2.3 [Apr-24-2002]

Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Z48402.r
         (269 letters)

Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa 
           29,161 sequences; 44,058,232 total letters

Searching..................................................done


                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

At1g04190.1  68414.m00409 tetratricopeptide repeat (TPR)-con...   424   e-118
At5g17020.1  68418.m01995 exportin1 (XPO1) nearly identical ...    36   0.14 
At2g18110.1  68415.m02105 elongation factor 1-beta, putative...    36   0.14 
At3g49810.1  68416.m05446 U-box domain-containing protein co...    34   0.56 
At3g20330.1  68416.m02576 aspartate carabmoyltransferase, ch...    34   0.56 

>At1g04190.1 68414.m00409 tetratricopeptide repeat (TPR)-containing protein low
            similarity to protein antigen LmSTI1 [Leishmania major]
            GI:1698880; contains Pfam profile PF00515 TPR Domain; EST
            gb|Z47802 and gb|Z48402 come from this gene
          Length = 1327

 Score =  424 bits (214), Expect = e-118
 Identities = 261/272 (95%), Gaps = 4/272 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    ttttgattcgaagatagccttttgactcaaaagttcaaagttttgtttgatcattagata 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1315 ttttgattcgaagatagccttttgactcaaaagttcaaagttttgtttgatcattagata 1256

                                                                        
Query: 61   agaaacaacaaaaaggnggattttttaagtagcacacactcgcaagaactcttttttatc 120
            ||| |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 1255 agatacaacaaaaaggtggattttctaagtagcacacactcgcaagaactcttttttatc 1196

                                                                        
Query: 121  ttttgagtcttgancaaaaactggatatagagaatcatactgcaacaaaacaatgcccta 180
            |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1195 tttttagtcttgatcaaaaactggatatagagaatcatactgcaacaaaacaatgcccta 1136

                                                                        
Query: 181  cgagcttttcggatttc-ccttgaaaatgcgagggagaatctca-gtgcgccgatatcca 238
            ||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1135 cgagcttttcg-atttctccttgaaaatgcgagggagaatctcatgtgcgccgatatcca 1077

                                            
Query: 239  gagcttgcgggtccc-gcacaaaggttgtccc 269
            |||||||||| |||| |||||||| |||||||
Sbjct: 1076 gagcttgcggttccctgcacaaagtttgtccc 1045



>At5g17020.1 68418.m01995 exportin1 (XPO1) nearly identical to Exportin1 (XPO1)
            protein [Arabidopsis thaliana] GI:7671510
          Length = 3884

 Score = 36.2 bits (18), Expect = 0.14
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 34   ttcaaagttttgtttgat 51
            ||||||||||||||||||
Sbjct: 3882 ttcaaagttttgtttgat 3865



>At2g18110.1 68415.m02105 elongation factor 1-beta, putative / EF-1-beta,
           putative nearly identical to eEF-1beta [Arabidopsis
           thaliana] GI:398606
          Length = 974

 Score = 36.2 bits (18), Expect = 0.14
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 137 aaaactggatatagagaa 154
           ||||||||||||||||||
Sbjct: 843 aaaactggatatagagaa 826



>At3g49810.1 68416.m05446 U-box domain-containing protein contains Pfam profile
           PF04564: U-box domain
          Length = 2298

 Score = 34.2 bits (17), Expect = 0.56
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 111 cttttttatcttttgag 127
           |||||||||||||||||
Sbjct: 121 cttttttatcttttgag 137



>At3g20330.1 68416.m02576 aspartate carabmoyltransferase, chloroplast /
           aspartate transcarbamylase / ATCase (PYRB) identical to
           SP|P49077 Aspartate carbamoyltransferase, chloroplast
           precursor (EC 2.1.3.2) (Aspartate transcarbamylase)
           (ATCase) {Arabidopsis thaliana}
          Length = 1675

 Score = 34.2 bits (17), Expect = 0.56
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 30  aaagttcaaagttttgtttga 50
           ||||||||||| |||||||||
Sbjct: 374 aaagttcaaagatttgtttga 394



  Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa
    Posted date:  Jun 25, 2004 12:58 PM
  Number of letters in database: 44,058,232
  Number of sequences in database:  29,161
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 8555
Number of Sequences: 29161
Number of extensions: 8555
Number of successful extensions: 705
Number of sequences better than 10.0: 42
length of query: 269
length of database: 44,058,232
effective HSP length: 16
effective length of query: 253
effective length of database: 43,591,656
effective search space: 11028688968
effective search space used: 11028688968
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)