BLASTN 2.2.3 [Apr-24-2002]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= ycF6.F
(90 letters)
Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa
29,161 sequences; 44,058,232 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
AtCg00210 ycf6#hypothetical protein 178 4e-45
At3g21650.1 68416.m02730 serine/threonine protein phosphata... 34 0.16
At4g30410.2 68417.m04320 expressed protein similar to cDNA ... 32 0.65
At2g34150.1 68415.m04180 expressed protein 32 0.65
At2g24600.3 68415.m02939 ankyrin repeat family protein cont... 32 0.65
>AtCg00210 ycf6#hypothetical protein
Length = 90
Score = 178 bits (90), Expect = 4e-45
Identities = 90/90 (100%)
Strand = Plus / Plus
Query: 1 atggatatagtaagtctcgcatgggctgctttaatggtagtttttacattttccctctct 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 atggatatagtaagtctcgcatgggctgctttaatggtagtttttacattttccctctct 60
Query: 61 ctcgtagtgtggggaagaagtggactctag 90
||||||||||||||||||||||||||||||
Sbjct: 61 ctcgtagtgtggggaagaagtggactctag 90
>At3g21650.1 68416.m02730 serine/threonine protein phosphatase 2A (PP2A)
regulatory subunit B', putative similar to
SWISS-PROT:Q28653 serine/threonine protein phosphatase
2A, 56 kDa regulatory subunit, delta isoform (PP2A, B
subunit, B' delta isoform, PP2A, B subunit, B56 delta
isoform, PP2A, B subunit, PR61 delta isoform, PP2A, B
subunit, R5 delta isoform, PP2A, B subunit, B'-gamma)
[Oryctolagus cuniculus]; contains Pfam domain, PF01603:
Protein phosphatase 2A regulatory B subunit (B56 family)
Length = 2336
Score = 34.2 bits (17), Expect = 0.16
Identities = 23/25 (92%)
Strand = Plus / Minus
Query: 38 tagtttttacattttccctctctct 62
||||||||| || ||||||||||||
Sbjct: 1370 tagtttttagatattccctctctct 1346
>At4g30410.2 68417.m04320 expressed protein similar to cDNA bHLH transcription
factor (bHLH eta gene) gi:32563007
Length = 1068
Score = 32.2 bits (16), Expect = 0.65
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 50 tttccctctctctcgt 65
||||||||||||||||
Sbjct: 19 tttccctctctctcgt 34
>At2g34150.1 68415.m04180 expressed protein
Length = 2822
Score = 32.2 bits (16), Expect = 0.65
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 48 attttccctctctctc 63
||||||||||||||||
Sbjct: 71 attttccctctctctc 86
>At2g24600.3 68415.m02939 ankyrin repeat family protein contains ankyrin repeats,
Pfam:PF00023
Length = 2187
Score = 32.2 bits (16), Expect = 0.65
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 74 gaagaagtggactcta 89
||||||||||||||||
Sbjct: 1131 gaagaagtggactcta 1146
Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa
Posted date: Jun 25, 2004 12:58 PM
Number of letters in database: 44,058,232
Number of sequences in database: 29,161
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2481
Number of Sequences: 29161
Number of extensions: 2481
Number of successful extensions: 749
Number of sequences better than 10.0: 18
length of query: 90
length of database: 44,058,232
effective HSP length: 16
effective length of query: 74
effective length of database: 43,591,656
effective search space: 3225782544
effective search space used: 3225782544
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)