BLASTN 2.2.3 [Apr-24-2002]

Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= ycF6.F
         (90 letters)

Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa 
           29,161 sequences; 44,058,232 total letters

Searching..................................................done


                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AtCg00210  ycf6#hypothetical protein                              178   4e-45
At3g21650.1  68416.m02730 serine/threonine protein phosphata...    34   0.16 
At4g30410.2  68417.m04320 expressed protein similar to cDNA ...    32   0.65 
At2g34150.1  68415.m04180 expressed protein                        32   0.65 
At2g24600.3  68415.m02939 ankyrin repeat family protein cont...    32   0.65 
>AtCg00210 ycf6#hypothetical protein
          Length = 90

 Score =  178 bits (90), Expect = 4e-45
 Identities = 90/90 (100%)
 Strand = Plus / Plus

                                                                      
Query: 1  atggatatagtaagtctcgcatgggctgctttaatggtagtttttacattttccctctct 60
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1  atggatatagtaagtctcgcatgggctgctttaatggtagtttttacattttccctctct 60

                                        
Query: 61 ctcgtagtgtggggaagaagtggactctag 90
          ||||||||||||||||||||||||||||||
Sbjct: 61 ctcgtagtgtggggaagaagtggactctag 90
>At3g21650.1 68416.m02730 serine/threonine protein phosphatase 2A (PP2A)
            regulatory subunit B', putative similar to
            SWISS-PROT:Q28653 serine/threonine protein phosphatase
            2A, 56 kDa regulatory subunit, delta isoform (PP2A, B
            subunit, B' delta isoform, PP2A, B subunit, B56 delta
            isoform, PP2A, B subunit, PR61 delta isoform, PP2A, B
            subunit, R5 delta isoform, PP2A, B subunit, B'-gamma)
            [Oryctolagus cuniculus]; contains Pfam domain, PF01603:
            Protein phosphatase 2A regulatory B subunit (B56 family)
          Length = 2336

 Score = 34.2 bits (17), Expect = 0.16
 Identities = 23/25 (92%)
 Strand = Plus / Minus

                                     
Query: 38   tagtttttacattttccctctctct 62
            ||||||||| || ||||||||||||
Sbjct: 1370 tagtttttagatattccctctctct 1346
>At4g30410.2 68417.m04320 expressed protein similar to cDNA bHLH transcription
          factor (bHLH eta gene) gi:32563007
          Length = 1068

 Score = 32.2 bits (16), Expect = 0.65
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                          
Query: 50 tttccctctctctcgt 65
          ||||||||||||||||
Sbjct: 19 tttccctctctctcgt 34
>At2g34150.1 68415.m04180 expressed protein
          Length = 2822

 Score = 32.2 bits (16), Expect = 0.65
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                          
Query: 48 attttccctctctctc 63
          ||||||||||||||||
Sbjct: 71 attttccctctctctc 86
>At2g24600.3 68415.m02939 ankyrin repeat family protein contains ankyrin repeats,
            Pfam:PF00023
          Length = 2187

 Score = 32.2 bits (16), Expect = 0.65
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                            
Query: 74   gaagaagtggactcta 89
            ||||||||||||||||
Sbjct: 1131 gaagaagtggactcta 1146
  Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa
    Posted date:  Jun 25, 2004 12:58 PM
  Number of letters in database: 44,058,232
  Number of sequences in database:  29,161
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2481
Number of Sequences: 29161
Number of extensions: 2481
Number of successful extensions: 749
Number of sequences better than 10.0: 18
length of query: 90
length of database: 44,058,232
effective HSP length: 16
effective length of query: 74
effective length of database: 43,591,656
effective search space: 3225782544
effective search space used: 3225782544
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)