BLASTN 2.2.3 [Apr-24-2002]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= AY102133.F
(588 letters)
Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa
29,161 sequences; 44,058,232 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
At1g01160.1 68414.m00026 SSXT protein-related / transcripti... 1166 0.0
At4g00850.1 68417.m00116 SSXT family protein low similarity... 200 9e-51
At1g01170.1 68414.m00028 ozone-responsive stress-related pr... 119 3e-26
At5g03030.1 68418.m00251 DNAJ heat shock N-terminal domain-... 38 0.081
At3g13062.2 68416.m01631 expressed protein weak similarity ... 36 0.32
>At1g01160.1 68414.m00026 SSXT protein-related / transcription
co-activator-related similar to SYT/SSX4 fusion protein
(GI:11127695) [Homo sapiens]; supporting cDNA
gi|21539891|gb|AY102640.1|; contains Pfam profile
PF05030: SSXT protein (N-terminal region)
Length = 1027
Score = 1166 bits (588), Expect = 0.0
Identities = 588/588 (100%)
Strand = Plus / Plus
Query: 1 atgcagcagcagcagtctccgcaaatgtttccgatggttccgtcgattccccctgctaac 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 227 atgcagcagcagcagtctccgcaaatgtttccgatggttccgtcgattccccctgctaac 286
Query: 61 aacatcactaccgaacagatccaaaagtaccttgatgagaacaagaagctgattatggcc 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 287 aacatcactaccgaacagatccaaaagtaccttgatgagaacaagaagctgattatggcc 346
Query: 121 atcatggaaaaccagaatctcggtaaacttgctgagtgcgcccagtaccaagctcttctc 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 347 atcatggaaaaccagaatctcggtaaacttgctgagtgcgcccagtaccaagctcttctc 406
Query: 181 cagaagaacttgatgtatcttgctgcaattgctgatgctcaacccccaccacctacgcca 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407 cagaagaacttgatgtatcttgctgcaattgctgatgctcaacccccaccacctacgcca 466
Query: 241 ggaccttcaccatctacagctgtcgctgcccagatggcaacaccgcattctgggatgcaa 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 467 ggaccttcaccatctacagctgtcgctgcccagatggcaacaccgcattctgggatgcaa 526
Query: 301 ccacctagctacttcatgcaacacccacaagcatcccctgcagggattttcgctccaagg 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 527 ccacctagctacttcatgcaacacccacaagcatcccctgcagggattttcgctccaagg 586
Query: 361 ggtcctttacagtttggtagcccactccagtttcaggatccgcaacagcagcagcagata 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 587 ggtcctttacagtttggtagcccactccagtttcaggatccgcaacagcagcagcagata 646
Query: 421 catcagcaagctatgcaaggacacatggggattagaccaatgggtatgaccaacaacggg 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 647 catcagcaagctatgcaaggacacatggggattagaccaatgggtatgaccaacaacggg 706
Query: 481 atgcagcatgcgatgcaacaaccagaaaccggtcttggaggaaacgtggggcttagagga 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 707 atgcagcatgcgatgcaacaaccagaaaccggtcttggaggaaacgtggggcttagagga 766
Query: 541 ggaaagcaagatggagcagatggacaaggaaaagatgatggcaagtga 588
||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 767 ggaaagcaagatggagcagatggacaaggaaaagatgatggcaagtga 814
>At4g00850.1 68417.m00116 SSXT family protein low similarity to synovial sarcoma
associated SS18-delta [Mus musculus] GI:17978535;
contains Pfam profile PF05030: SSXT protein (N-terminal
region)
Length = 1045
Score = 200 bits (101), Expect = 9e-51
Identities = 146/161 (90%)
Strand = Plus / Plus
Query: 64 atcactaccgaacagatccaaaagtaccttgatgagaacaagaagctgattatggccatc 123
||||| |||||||||||||||||||| ||||||||||||||||||||||| ||||| |||
Sbjct: 168 atcaccaccgaacagatccaaaagtatcttgatgagaacaagaagctgataatggcgatc 227
Query: 124 atggaaaaccagaatctcggtaaacttgctgagtgcgcccagtaccaagctcttctccag 183
||||||| ||||| |||||||||||||| || || || ||||| |||||||||||||||
Sbjct: 228 ttggaaaatcagaacctcggtaaacttgcagaatgtgctcagtatcaagctcttctccag 287
Query: 184 aagaacttgatgtatcttgctgcaattgctgatgctcaacc 224
||||| ||||||||||| ||||||||||| |||||||||||
Sbjct: 288 aagaatttgatgtatctcgctgcaattgcggatgctcaacc 328
Score = 87.7 bits (44), Expect = 1e-16
Identities = 103/123 (83%), Gaps = 6/123 (4%)
Strand = Plus / Plus
Query: 343 gggattttcgctccaaggggtcctttacagtttggtagcccactccagtttcaggatccg 402
||||||||| |||| || ||||| || || ||||||||||| | ||||||| |||||||
Sbjct: 468 gggattttccctcctagaggtccattgcaatttggtagcccgcatcagtttctggatccg 527
Query: 403 caacagcagcagcagatacatcagcaagctatgcaaggacacatggggattagaccaatg 462
|| ||| ||| ||||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 528 ca------gcaacagttacatcaacaagctatgcaagggcacatggggattagaccaatg 581
Query: 463 ggt 465
|||
Sbjct: 582 ggt 584
Score = 34.2 bits (17), Expect = 1.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 300 accacctagctacttcatgca 320
|||||| ||||||||||||||
Sbjct: 407 accaccaagctacttcatgca 427
>At1g01170.1 68414.m00028 ozone-responsive stress-related protein, putative
similar to stress-related ozone-induced protein AtOZI1
(GI:790583) [Arabidopsis thaliana]; contains 1 predicted
transmembrane domain;
Length = 609
Score = 119 bits (60), Expect = 3e-26
Identities = 60/60 (100%)
Strand = Plus / Minus
Query: 529 gggcttagaggaggaaagcaagatggagcagatggacaaggaaaagatgatggcaagtga 588
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 609 gggcttagaggaggaaagcaagatggagcagatggacaaggaaaagatgatggcaagtga 550
>At5g03030.1 68418.m00251 DNAJ heat shock N-terminal domain-containing protein
contains Pfam profile PF00226 DnaJ domain; DNAJ
domain-containing protein, Homo sapiens, EMBL:AF126743
Length = 665
Score = 38.2 bits (19), Expect = 0.081
Identities = 25/27 (92%)
Strand = Plus / Minus
Query: 402 gcaacagcagcagcagatacatcagca 428
|||||||||||||||| |||| |||||
Sbjct: 240 gcaacagcagcagcagctacagcagca 214
>At3g13062.2 68416.m01631 expressed protein weak similarity to SP|Q9UKL6
Phosphatidylcholine transfer protein (PC-TP) {Homo
sapiens}
Length = 1716
Score = 36.2 bits (18), Expect = 0.32
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 203 ctgcaattgctgatgctcaacc 224
||||||||||| ||||||||||
Sbjct: 724 ctgcaattgctcatgctcaacc 703
Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa
Posted date: Jun 25, 2004 12:58 PM
Number of letters in database: 44,058,232
Number of sequences in database: 29,161
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 20,054
Number of Sequences: 29161
Number of extensions: 20054
Number of successful extensions: 1909
Number of sequences better than 10.0: 48
length of query: 588
length of database: 44,058,232
effective HSP length: 17
effective length of query: 571
effective length of database: 43,562,495
effective search space: 24874184645
effective search space used: 24874184645
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)