BLASTN 2.2.3 [Apr-24-2002]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= AV821553_RAFL04_13_H03.f
(364 letters)
Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa
29,161 sequences; 44,058,232 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
At1g01160.1 68414.m00026 SSXT protein-related / transcripti... 577 e-164
At5g64920.1 68418.m08166 COP1-interacting protein (CIP8) / ... 40 0.012
At5g51560.1 68418.m06393 leucine-rich repeat transmembrane ... 38 0.049
At1g06900.1 68414.m00733 peptidase M16 family protein / ins... 38 0.049
At5g62500.1 68418.m07844 microtubule-associated EB1 family ... 36 0.19
>At1g01160.1 68414.m00026 SSXT protein-related / transcription
co-activator-related similar to SYT/SSX4 fusion protein
(GI:11127695) [Homo sapiens]; supporting cDNA
gi|21539891|gb|AY102640.1|; contains Pfam profile
PF05030: SSXT protein (N-terminal region)
Length = 1027
Score = 577 bits (291), Expect = e-164
Identities = 293/294 (99%)
Strand = Plus / Plus
Query: 2 atttttggtcataaaatccacacagaggtggttcgacatccaggtgaatccaagtaataa 61
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20 atttttggtcataaaatccacacagaggtggttcgacatccaggtgaatccaagtaataa 79
Query: 62 attgcaggattctctctctataatatatatagatatagcttgcaatcatttcctgcgttt 121
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 80 attgcaggattctctctctataatatatatagatatagcttgcaatcatttcctgcgttt 139
Query: 122 ggatcggtctgggttttgtcgagggttttttggggaagacgaaattagggtttagttggg 181
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 140 ggatcggtctgggttttgtcgagggttttttggggaagacgaaattagggtttagttggg 199
Query: 182 gcaaagtaagtagtaaagaagaagaagatgcagcagcagcagtctccgcaaatgtttccg 241
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 200 gcaaagtaagtagtaaagaagaagaagatgcagcagcagcagtctccgcaaatgtttccg 259
Query: 242 atggttccgtcgattccccctgctaacaacatnactaccgaacagatccaaaag 295
|||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 260 atggttccgtcgattccccctgctaacaacatcactaccgaacagatccaaaag 313
>At5g64920.1 68418.m08166 COP1-interacting protein (CIP8) / zinc finger
(C3HC4-type RING finger) family protein identical to
COP1-interacting protein CIP8 [Arabidopsis thaliana]
gi|5929906|gb|AAD56636; contains Pfam profile: PF00097
zinc finger, C3HC4 type
Length = 1555
Score = 40.1 bits (20), Expect = 0.012
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 197 aagaagaagaagatgcagcagcag 220
||||||||||||| ||||||||||
Sbjct: 1088 aagaagaagaagaagcagcagcag 1065
Score = 34.2 bits (17), Expect = 0.77
Identities = 23/25 (92%)
Strand = Plus / Minus
Query: 199 gaagaagaagatgcagcagcagcag 223
||||||||||| | |||||||||||
Sbjct: 1089 gaagaagaagaagaagcagcagcag 1065
>At5g51560.1 68418.m06393 leucine-rich repeat transmembrane protein kinase,
putative
Length = 2404
Score = 38.2 bits (19), Expect = 0.049
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 197 aagaagaagaagatgcagcagca 219
||||||||||||||| |||||||
Sbjct: 159 aagaagaagaagatgaagcagca 137
>At1g06900.1 68414.m00733 peptidase M16 family protein / insulinase family
protein contains Pfam domain, PF05193: Peptidase M16
inactive domain; similar to insulin-degrading enzyme
(Insulysin, Insulinase, Insulin protease) [Mouse]
SWISS-PROT:Q9JHR7
Length = 3409
Score = 38.2 bits (19), Expect = 0.049
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 197 aagaagaagaagatgcagcagcagcag 223
||||||| |||| ||||||||||||||
Sbjct: 42 aagaagaggaagctgcagcagcagcag 68
>At5g62500.1 68418.m07844 microtubule-associated EB1 family protein similar to
EBF3-S (Microtubule-associated protein) [Homo sapiens]
GI:12751131; contains Pfam profiles PF00307: Calponin
homology (CH) domain, PF03271: EB1 protein
Length = 1408
Score = 36.2 bits (18), Expect = 0.19
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 197 aagaagaagaagatgcagcagc 218
||||||||||||| ||||||||
Sbjct: 1127 aagaagaagaagaagcagcagc 1148
Score = 34.2 bits (17), Expect = 0.77
Identities = 23/25 (92%)
Strand = Plus / Plus
Query: 197 aagaagaagaagatgcagcagcagc 221
||||||||||||| | |||||||||
Sbjct: 1124 aagaagaagaagaagaagcagcagc 1148
Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa
Posted date: Jun 25, 2004 12:58 PM
Number of letters in database: 44,058,232
Number of sequences in database: 29,161
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 27,979
Number of Sequences: 29161
Number of extensions: 27979
Number of successful extensions: 7084
Number of sequences better than 10.0: 133
length of query: 364
length of database: 44,058,232
effective HSP length: 17
effective length of query: 347
effective length of database: 43,562,495
effective search space: 15116185765
effective search space used: 15116185765
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)