BLASTN 2.2.3 [Apr-24-2002]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= PTA.CL.48.cl.4890.Contig1
(348 letters)
Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa
29,161 sequences; 44,058,232 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
At5g46780.1 68418.m05762 VQ motif-containing protein contai... 523 e-148
At5g46780.2 68418.m05763 VQ motif-containing protein contai... 186 8e-47
At5g03545.1 68418.m00311 expressed protein No ATG start, an... 44 8e-04
At1g69360.1 68414.m07960 expressed protein 44 8e-04
At1g18750.1 68414.m02338 MADS-box protein (AGL65) similar t... 44 8e-04
>At5g46780.1 68418.m05762 VQ motif-containing protein contains PF05678: VQ motif
Length = 1017
Score = 523 bits (264), Expect = e-148
Identities = 311/327 (95%), Gaps = 2/327 (0%)
Strand = Plus / Minus
Query: 22 tgaggggtttggtgntgaatttggtggnttggnggnanctttacgaatgntttttcccca 81
|||||| |||| || ||| |||| ||| |||| || | ||||||||||| |||||||| |
Sbjct: 329 tgagggttttgttgttgattttgttggtttggtgg-atctttacgaatgttttttccc-a 272
Query: 82 tcttattcacaccaagatgatgatgatgatgatcattattatgattatcattaccacgat 141
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 271 tcttattcacaccaagatgatgatgatgatgatcattattatgattatcattaccacgat 212
Query: 142 tactctgntcatccattattaaaactgaaacaaacaaacaaaacagngnaaatccaaatc 201
||||||| |||||||||||||||||||||||||||||||||||||| | |||||||||||
Sbjct: 211 tactctgatcatccattattaaaactgaaacaaacaaacaaaacagagcaaatccaaatc 152
Query: 202 ttgggaaggaaatattagagaaaccacaaagacttaaaccacaagaagatttaaaccaag 261
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 151 ttgggaagaaaatattagagaaaccacaaagacttaaaccacaagaagatttaaaccaag 92
Query: 262 aacctctctaaaacaagtaaaatcaagggttttatnacaaacccttttaacgagaaagag 321
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 91 aacctctctaaaacaagtaaaatcaagggttttataacaaacccttttaacgagaaagag 32
Query: 322 aacttacgcgttttctgaatttgactg 348
|||||||||||||||||||||||||||
Sbjct: 31 aacttacgcgttttctgaatttgactg 5
>At5g46780.2 68418.m05763 VQ motif-containing protein contains PF05678: VQ motif
Length = 917
Score = 186 bits (94), Expect = 8e-47
Identities = 132/144 (91%), Gaps = 2/144 (1%)
Strand = Plus / Minus
Query: 22 tgaggggtttggtgntgaatttggtggnttggnggnanctttacgaatgntttttcccca 81
|||||| |||| || ||| |||| ||| |||| || | ||||||||||| |||||||| |
Sbjct: 230 tgagggttttgttgttgattttgttggtttggtgg-atctttacgaatgttttttccc-a 173
Query: 82 tcttattcacaccaagatgatgatgatgatgatcattattatgattatcattaccacgat 141
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 172 tcttattcacaccaagatgatgatgatgatgatcattattatgattatcattaccacgat 113
Query: 142 tactctgntcatccattattaaaa 165
||||||| ||||||||||||||||
Sbjct: 112 tactctgatcatccattattaaaa 89
Score = 40.1 bits (20), Expect = 0.012
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 329 gcgttttctgaatttgactg 348
||||||||||||||||||||
Sbjct: 88 gcgttttctgaatttgactg 69
>At5g03545.1 68418.m00311 expressed protein No ATG start, annotated according to
PMID:11123795
Length = 695
Score = 44.1 bits (22), Expect = 8e-04
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 97 gatgatgatgatgatgatcatt 118
||||||||||||||||||||||
Sbjct: 313 gatgatgatgatgatgatcatt 292
Score = 36.2 bits (18), Expect = 0.19
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 97 gatgatgatgatgatgat 114
||||||||||||||||||
Sbjct: 316 gatgatgatgatgatgat 299
Score = 34.2 bits (17), Expect = 0.73
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 97 gatgatgatgatgatga 113
|||||||||||||||||
Sbjct: 347 gatgatgatgatgatga 363
Score = 34.2 bits (17), Expect = 0.73
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 98 atgatgatgatgatgat 114
|||||||||||||||||
Sbjct: 318 atgatgatgatgatgat 302
Score = 32.2 bits (16), Expect = 2.9
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 99 tgatgatgatgatgat 114
||||||||||||||||
Sbjct: 346 tgatgatgatgatgat 361
>At1g69360.1 68414.m07960 expressed protein
Length = 3259
Score = 44.1 bits (22), Expect = 8e-04
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 97 gatgatgatgatgatgatcatt 118
||||||||||||||||||||||
Sbjct: 90 gatgatgatgatgatgatcatt 111
>At1g18750.1 68414.m02338 MADS-box protein (AGL65) similar to homeodomain
transcription factor (AGL30) GI:3461830 from [Arabidopsis
thaliana]; contains Pfam domain PF00319: SRF-type
transcription factor (DNA-binding and dimerisation
domain); PMID: 12837945
Length = 1170
Score = 44.1 bits (22), Expect = 8e-04
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 97 gatgatgatgatgatgatcatt 118
||||||||||||||||||||||
Sbjct: 1072 gatgatgatgatgatgatcatt 1051
Score = 32.2 bits (16), Expect = 2.9
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 99 tgatgatgatgatgat 114
||||||||||||||||
Sbjct: 1073 tgatgatgatgatgat 1058
Database: ../PTA.blast_byTAIR/DB/ATH1_cdna_cm_20040228.fa
Posted date: Jun 25, 2004 12:58 PM
Number of letters in database: 44,058,232
Number of sequences in database: 29,161
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 22,464
Number of Sequences: 29161
Number of extensions: 22464
Number of successful extensions: 5642
Number of sequences better than 10.0: 663
length of query: 348
length of database: 44,058,232
effective HSP length: 17
effective length of query: 331
effective length of database: 43,562,495
effective search space: 14419185845
effective search space used: 14419185845
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)